Saturday, August 31, 2019

Parris and Procter Essay

How does Miller use setting and action in Set 1of ‘the Crucible’ to establish atmosphere and set the scene for the events which are to unfold?  This essay recounts the various ways in which Arthur Miller uses setting and action to set the atmosphere for the coming events in ‘the Crucible’. During the 1950’s whilst ‘the Crucible’ was being written a phenomenon called McCarthyism was occurring. McCarthy, who was the US president at the time, was determined to hunt down communists in the USA. He was paranoid about Communists and McCarthyism is the name given to the paranoid behaviour of his government in the hunt for communists. Miller was called in front of the judge and was tried, as were a number of his friends, but Miller was not convicted although others were. This is where Miller’s idea for ‘the Crucible’ originated. The link between McCarthyism and the witch-hunt is persecution, which is a common parallel in both situations. Being based on a true story about a historical witch-hunt creates dramatic tension in that the audience are expecting a play based on fact rather than fiction. The audience at the time would have known that the play was about McCarthyism, and by claiming that the play was based on fact Miller creates excitement in the audience who are prepared for a factual account of McCarthyism. It is notable that Miller was unable to perform his play publicly in the US at the time and it had to be performed in Belgium. By using the Salem witch-hunts Miller introduces the audience to the theme of good and evil. The setting and actions in Set 1 establishes atmosphere in particular for the events that are to unfold in the rest of the play. Set 1 in Act 1 is a small, simple bedroom. Within the room there isn’t much furniture and the room appears to be very cold and inhospitable. The room is brightened up by the description of the morning sunlight streaming in through the window, but the window is described as narrow so dulling the image of the room and limiting the sunlight streaming in through the window. The audience then has an image of a small slit of light entering a room of darkness, which creates a visual drama between light and dark. Similarly, the set in Act 2 is described by Miller as ‘the low, dark and rather long living room of the time.’ Again the Set which is a room in Act 3 is described as ‘solemn, even forbidding. Heavy beams jut out, boards of random widths make up the walls.’ As in set 1 there are two ‘high’ windows with ‘sunlight pouring through’. Finally in set 4 Miller describes the prison cell as ‘in darkness but for the moonlight seeping through the bars.’ The set of act 1 indicates a similar parallel in the set of the scene of John Procter in a prison cell, with the light streaming through. Whilst the audience contemplates whether there is hope of Proctor not being accused of dealing in witchcraft, sunlight streams in to the courtroom from the high windows. This represents a glimmer of hope for John Procter. Proctor’s wife then lies to say that her husband is not a lecher, thinking that she is protecting him, and the audience sees all hope dashed away. Later in Set 4 in the prison cell Miller uses the metaphor of moonlight seeping through the bars to show that not all is lost in despair. In all these sets Miller uses the stylistic device of light coming through windows in dark rooms making the audience think that the whole story will be dark with small glimmers of hope throughout. The use of light and dark in the set draws on a parallel of good and evil, hope and despair, justice and injustice. By allowing darkness rather light to dominate so despair, injustice and evil form the dominant atmosphere. The changing atmosphere in the similar settings leaves the audience un-prepared for what is going to take place next. Set 1, as can be seen by examining the text further, the bedroom is always full of tension and it is never the set for anything calm. Bedrooms are normally where people go to relax and sleep but this bedroom is the place where people go to argue and accuse each other of waywardness. This particular bedroom doesn’t belong to anyone and is described as ‘A small upper bedroom’. Bedrooms are normally personalised and made comfortable for the persons whose room it is but this one is cold and bland. This at once tells the audience that this room will be the centre for grievances and dilemma. The first character the audience meets in Act 1 is Reverend Samuel Parris, who is described as in his middle forties. The audience instantaneously get the impression that Parris is a man easily angered as his first words spoken are â€Å"Out of here!† Here Miller adds the action of Parris â€Å"scrambling to his feet in a fury†, which immediately creates tension. Reverend Parris’ short temper and his desperate manner, which he uses to get what he wants, are seen here. His intense anger comes through again when he is arguing with John Proctor â€Å"Man! Don’t a minister deserve a house†¦.†. Parris’s greed shines through and the audience sees a man out to get what he wants and not what’s best for the Church, which he is meant to serve. The audience also see his pretentiousness â€Å"I am a graduate of Harvard College†. He seems to believe that he is superior to everyone else. The confrontation in set 1 Act 1 set the scene for what is to be a far more serious conflict between Parris and Procter in the courtroom. At this point a different atmosphere is created by the tension. Here again there is an argument between Parris and Procter, but roles are reversed, and Proctor seems to be in control. The tension is also amplified by the way in which Parris speaks â€Å"in deadly fear, to Elizabeth†. Deadly fear is strong language and emphasises to the audience that death is in the air. Set 1 Act 1 also prepares the audience for Act 4 Parris is seen out of character where he is grovelling and begging for Procter to confess to dealing with witchcraft, demonstrating the extent to which Parris will go to get a confession, which the audience knows is false.

Friday, August 30, 2019

Accounting System Paper Essay

Kudler Fine Foods has done a wonderful job with its current accounting system by manually tracking data and not having a uniform system for providing information about that data. Data is the raw and unorganized version of information while information is categorized and decipherable data that correlates to the business. Kudler Fine Foods is making a transition from the less efficient and more labor intensive accounting methods to a technology based accounting system which saves money being that it is more efficient and more robust. The core features, benefits, and cost will be discussed as you continue to read this paper. As mentioned earlier, Kudler Fine Foods is making a transition to a computerized accounting system which will have the ability to communicate with all branches of the business. Kudler Fine foods will utilize an accounting system which is integral part of the Enterprise resource planning software that is being deployed in the Kudler Fine Foods environment. The ERP software will be able to capture real time data directly from the point of sale (cash registers) and automatically adjust inventory and profit data. See more:Â  Social Satire in The Adventures of Huckleberry Finn Essay The accounting software will also use a compliance management feature will provide complete transaction audit trails and rules-based controls and advanced reporting capabilities which are compliant with laws and regulations. More benefits are advanced financial forecasting the can accurately predict and estimate potential profits and pending losses, revenue and cash flow. This gives Kudler Fine Foods the ability to analyze past trends to help make better business decisions in the future. In addition, the accounting software will give Kudler Fine Foods the ability to deep dive into the cash management aspect of their business by more accurately assessing current and future cash needs and track all transactions that directly impact available cash levels. In an ERP environment, Kudler Fine Foods will adopt a client/server system. The Client/Server technology model is the model in which today’s softwares are developed. A Client/Server model is one in which the client computer is identified separately from the server computer. This will require servers with Windows serve 2008 and networking equipment which will allow all workstations to communicate to application servers, shared data drives and communicate with the outside world. With the added benefits of an ERP system in the Kudler Fine Food environment, comes an added expense of support of the system. Currently, Kudler Fine Foods can anticipate an expense of twenty-five thousand dollars with a potential ceiling of two hundred fifty thousand dollars. References Top 10 ERP. (2012). Retrieved from http://www.top10erp.org/sap-erp-software-comparison-technology-140 Technology required for Erp. (2012). Retrieved from http://www.vkinfotek.com/erp/erp-technologies.html

A Microeconomic Analysis of Indian Retail Industry

MODERN RETAIL MICRO ECONOMICS PROJECT REPORT ABSTRACT The growing number of modern retail outlets in India on the one hand and frequent sale seasons and talks of underperformance on the other point to a mixed bag and make us wonder whether the sector is on the right growth trajectory. In this report, rather than providing with just the facts, we have tried to understand the modern retail sector from an economist’s point of view and visualize its future-whether it is in its expansion or contraction phase.Motivated by the rising per-capita incomes and increased spending on consumer goods, modern retail stores are coming up with new strategies and plans to unlock the Pandora box of the untapped and unorganized retail sector. In the course of the report, we try to find out – how the retail sector works, major regulations that affect its functioning and the challenges that await the sector and summarize with our analysis and recommendations. Note: We have used where weâ€⠄¢ve analyzed the situation from a micro-economic point of view. INTRODUCTIONThe retail sector in India can broadly be classified as organized and unorganized where the share of unorganized sector is more than 93% of the total and includes the kirana stores, mom and pop stores and the ilk. The organized or modern retail sector on the other hand captures a mere 7% of the total market share. Modern retail is defined as a form of retailing whereby consumers can buy goods from a similar purchase environment across more than one physical location and operates under three levels: Specialist stores catering to some particular category of product such as footwear, pharma & beauty, food and grocery etc. classified under level I. Departmental stores that cater to a few categories of retail put under level II, and malls where we find an agglomeration of many departmental stores, hypermarkets etc – classified under level III retail. The figure 1 below shows the various players at differe nt levels of retail. Retail stores can also be classified under ‘lifestyle’, ‘value’ and ‘luxury’ formats based upon the consumer income segment they target.Figure : Players operating at different levels Figure: Organized Retail Although, the sector boasts of covering almost all the verticals, a look at the markets under different verticals shows that Organized Retail Penetration is extremely low – 2. 4 percent – for the food and grocery, which in contrast makes up for the biggest part of the total retail market. The apparels, foot wear and home decor are the major contributors under organized retail and have been prospering at a rapid pace.The figures below depict the market share and Organized Retail Penetration in different verticals. Figure: Market Share of Different Verticals in Organized Retail Source: CRISIL Figure: Organized retail penetration (%) in different verticals Source: CRISIL Retail almost accounts for around 15% of India’s GDP and thus plays an important role in determining the Indian economic indicators. Organized retail became the apple of everyone’s eye when Vishal Mega Mart profited from its operations in different parts of India.Soon, other players started with their own retail chains such as V-Mart, Big Bazaar, Subhiksha, Pantaloons et al and the market turned into a very competitive market, probably lowering the economic profits of the retailers, and consequently the situation now is that Vishal, Subhiksha and others stand nowhere compared to the biggies such as Reliance, Big Bazaar and others. The major reasons for this are the marketing mix of these brands and benefits from economies of scale. However, because a number of factors go into determining business profitability, it would not be correct to give all credit to the above mentioned factors.Let’s now look at the major player in organized retail in India. MAJOR PLAYERS The organized retail sector of India h as many domestic corporate houses competing with their ventures such as Tata’s Chroma, Reliance Trends, Reliance Fresh, Futures Pantaloons, RPG & so on. Other than these, fascinated by the Indian demographics and potential market, international players have entered through joint ventures with national players and are planning to compete for the share through such strategies.Major players along with their brands are shown below. * Landmark (books and music) * Croma(multi-brand electronics) * World of Titan (watches) * Tanishq (jewellery) * Titan Eye+ (eye wear) * Westside (lifestyle retail store) * Star Bazaar (hypermarket chain) * Fashion Yatra(family fashion store) * Central (shopping mall) * Big Bazaar (hypermarket) * Pantaloons (fashion outlet) * Blue Sky (sunglasses) * Brand Factory (multi-brand readymade garments) * KB's Fair Price (essential products) * Navaras(jewellery) Planet Store (multi-brand sports and lifestyle speciality retail) * aLL(fashion garments) * Ethnici ty (Indian ethnic wear) * Home Town (home needs), * eZone(electronics), * Furniture Bazaar (home furniture), * Electronics Bazaar(under Big Bazaar, electronics stores) * Home Bazaar (satellite version of Home Town) * Collection I (lifestyle furniture) * Gen M ; One Mobile (mobile phones) * M-Port (electronics) * Shoe Factory (footwear) * Depot (books and music) * Reliance Fresh (neighbourhood store) * Reliance Mart (supermarket) * Reliance Super (mini-mart) Reliance Digital (consumer durables and information technology) * Reliance Trends (apparel and accessories) * Reliance Wellness (health, wellness and beauty) * iStore(Apple products) * Reliance Footprint (footwear) * Reliance Jewels (jewellery) * Reliance TimeOut(books, music and entertainment) * Reliance AutoZone (automotive products and services) * Reliance Living (home ware, furniture, modular kitchens and furnishings) * Music World (music and home video store) * Books ; Beyond (book store) * Spencers (multi-format retail stor e) K RAHEJA Shoppers Stop (clothing, accessories, fragrances, cosmetics, footwear and home furnishing store) * Crossword (book store) * Inorbit Mall (fashion, lifestyle, food and entertainment) and Hyper City (hypermarket) As we can see that all major groups in India have opened up their retail stores catering to different sections of the society providing for different needs of the customers. This has resulted in a sort of monopolistic competition in organized retail market in metro and Tier 1cities owing to the large number of variants being offered to the customers.However, in Tier 2 and 3 cities there are fewer of such modern retail stores and the market situation can be compared to oligopoly, but however because of local players and unorganized retail the effects of oligopoly generally don’t show up. The presence of competitors thus affects not only the player, but the industry and the nation as whole. Let’s discuss in brief the effects of competition. COMPETITION AND RIVALRY Competition is one of the means to achieve economic efficiency.It restrains prices and encourages companies to innovate ; provide better quality of products. In the retail sector competition is driven by many factors, including variety, products, price, quality, service, location, reputation, credit and availability of retail space etc. It can broadly be classified under: 1. Competition because of Internal Factors The large number of groups in multibrand retail such as TATA, Raheja et al and also single brand established foreign players such as Adidas, Nike etc pose a threat to speedy expansion of Indian Retail. . Competition because of External Factors The organized retail industry in India is facing immense competition from the unorganized sector. Traditionally, retailing has been established in India for centuries. It is a low cost structure, mostly owner operated, has negligible real estate and labor costs and little or no taxes to pay. The unorganized retail sector constitutes over 93% of India’s total retail sector and thus, poses a serious hurdle for organized retailers.Because of the largely unorganized nature of Indian retail, inefficiencies have crept in and large number of intermediaries exists, reducing the functional and productive efficiency of the retail industry. The government in power has thus been keen to promote FDI in retail in India. Hundred percent FDI in single brand retail invited global companies for competition in the Indian retail sector. With this the companies are working with a strategy so as to be able to cater to the needs of the consumers and grow volumes by ensuring footfalls, while being able to reduce costs, withstand downturns, and face competition.Here we also see a common practise to prevent other companies from affecting the economic status quo of a country, by imposing barriers and caps on FDI, for example what has been done in multibrand retail. As of now, FDI in multibrand retail cannot exceed the specified cap which has kept global retailers such as Walmart, Carrefour et al from entering the Indian market, although they still do exist in whole sale cash and carry segment.The market structure of the modern retail is that of monopolistic competition in metros ; tier I cities which usually have hundreds of shopping alternatives including multi-brand retail outlets, single brand outlets in the shopping malls and nation-wide chains. Whereas in the tier II ; tier III cities the market structure is oligopoly in nature as they have fewer stores and somewhere only a single super centre or shopping mall. Also if we look at prices of different products in various retail outlets, we find that there is not much difference between the prices, except during periods or seasons of sale.This shows that because of the very competitive nature of modern retail, which now also includes online retail, the players are almost operating at zero economic profit, and thus don’t have much scope to offer different prices for similar products. Moreover almost all use similar technologies and processing techniques to provide the final product and thus the prices cannot be increased significantly, for fear of loss of market share. For example, Pantaloons and Westside have almost the similar brands in offering for the customer, leaving little scope for differentiation or price discrimination.Price discrimination can however happen when we compare lifestyle or luxury and value format stores, value stores charging lesser price for the same product sold at a higher price in lifestyle stores. To gain advantage in such a competitive environment major retailers have started to distinguish themselves by providing products under ‘private labels’. In India, fresh produce purchases are made more often from cart vendors who buy their stock from wholesalers. Retailers have tried to bridge the gap with direct farm procurement  eliminating middlemen and introducing  Ã¢â‚¬Ëœ private labels'.They are coming up with new ideas to grab a major share of the market which is prospering (see figure below) because of the following factors: The average income of the middle class population has been increasing at a rate of around 12%, which will result in increased expenditure Increasing proportion of working women in the country Increasing population of employed youth Increasing desire for better standards of living and trends in consumer expenditure Increase in the use of plastic money Emerging markets in Tier II and Tier III citiesFigure: Sales (in million Rs. ) plotted against the financial year Source: Company official website These factors may cause a shift in the demand curve, but more number of retailers will be willing to enter and eventually the price would not be impacted much. There would, infact a gradual shift from unorganized to the organized retail. All these and a huge untapped market potential that’s locked in the unorganized retail has mo tivated modern retailers to invest heavily in marketing and advertising, to grab customer attention and retain them.ADVERTISING Promoting the modern retail brand is very important – especially in metro and Tier I cities. The retailer must strive hard to communicate the USP of the brand and help the end-users know to which brand a particular product belongs influencing the buying behavior of the customer. Not only in India, retail industry all over the world spends large amount of funds on advertising. The figure below shows comparison of expenditure by the retail sector with others on online advertising in the United StatesFigure 5: US Online Ad Spending The growth of online video ads among the brand marketers and Social networking are primary contributors to the growing market share of the retail sector. Advertising in modern retail is broadly done under the following three categories: Traditional Advertising Traditional advertising means advertising using traditional media such as TV, newspaper, radio, circulars, hoardings etc. For eg. we frequently see advertisements from major retail players such as Big Bazaar, Chroma etc in newspapers.Digital Advertising This form uses advertising using digital media. Video advertising, Mobile advertising etc are some of its examples. Alternative Offers Under this we may have guerilla marketing where the marketer may use graffiti, fliers, deal of the day type offers, groupon etc to promote or advertise the product. Website Communication or on-site communication evaluates how well retailers currently collect the kind of information that helps them localize their own communications with consumers.For this category, we evaluate two criteria: whether the retailer offers localized information about their own stores on their eCommerce site, and whether they solicit customer information – email address and mobile number, prominently on their site. The expansion of the retail sector and the creation of meta-mediarie s has provided with increasing job opportunities. JOB CREATION With a CAGR of around 14. 5% in the last five years and the bright prospects of expansion , the the no of jobs in this sector are expected to grow at a fast pace.The existing players will have to face competition from the new players and this would also lead to opening up of new stores and thereby increasing the job opportunities in the country. Shift in consumers preference from traditional stores and shops to departmental stores and hypermarkets is definitely going to put pressure on retailers to provide for adequate staff and services, thereby increasing the number of people employed and thus creating job opportunities. The rural market is home to the 46% of the rich and prosperous people of the country. Besides, these people stay in 17% of the villages of the country.The infrastructure costs in setting up retail outlets in these places are going to be lower compared to the cities. This will encourage the emergence of regional players and would again lead to creation of jobs in many regions. However, some more prospering regions or cities which have shown good growth rates will have an edge over others, even in the same state. Whatever is the case, the supply has to be met with the demand, especially when there is no dearth of labor in India and job creation is highly likely, an event when it comes to the retail sector expansion and penetration.FDI in multi-brand retail is going to be a deciding factor in creation of jobs as well. Once permitted, this will lead to aggressive competition. The entry of new players would balance the supply chain and farmers will be benefitted. If this happens, more people will be attracted towards farming, also contract farming would lead to creation of rural jobs. Moreover, entry of foreign investors is likely to shift the production possibility frontier outwards(see figure below), because they are more likely to invest in storage, supply chain and other capital g oods.Retail sector is expected to expand by leaps and bounds in the near future and this would create a lot of jobs. The advancement of technology though can also reduce the manpower required in the long run and the jobs created over a period of time may get killed. The entry of multi brand retailers may also adversely impact the local kirana walas, because they will be able to recover there fixed cost easily and gain from economies of scale. Further, because all food and grocery require very similar capital investment, they also stand to gain from economies of scope.Figure: Expansion of Production Possibility frontier (not by reducing consumption but with introduction of new technology) RECENT TRENDS Growth of Modern Retail India moved from being 10th largest economy in 1990 to 4th largest in 2010 according to Purchasing Power Parity (PPP). The growing economy has driven the growth in per capita income of Indian consumers. Indian retail sector (organized and unorganized) has grown by 14. 5% from 2006-07 to 2011-12 and is valued at $396 billion out of which 5-6% is the share of organized retail.Organized retail has had growth more than double of total retail. With the overall rise the penetration of organized retail sector has increased and is expected to grow its share to 10% by the year 2016. Changing shopping behavior Shopping behavior has changed over time, with growing urbanization there has been rise in affluence and growing attraction towards branded goods. The parameters over which modern retail has been faring better than traditional retail are product assortment and range, quality, everything under single roof model. FDI in retail FDI in Single Brand:In 2006, FDI in single brand retail was permitted to the extent of 51% which has recently been increased to 100% in Jan, 2012. There is also a mandate of sourcing of goods from local SMEs and local dealers. FDI in multi-brand sector: International retailers are allowed 100% ownership in cash ; carry whol esale trade stores. But similar initiative in multi-brand retail stores, i. e. allowing 51% FDI has been met by widespread rejection and has been put on hold. Online Retailing Online retailing is gaining popularity in India with growing penetration of internet.It is expected that online retail will triple in size by 2014-15. It will be dominated by branded, low ticket size, easily transportable, lifestyle products and books. Flipkart and Yebhi. com have already established themselves as major players in this segment in the Indian market. Challenges posed by recent developments Indian government intended to bring 51% FDI in multi-retail sector but due to its widespread opposition, it has not been approved yet. This has put entry of world’s leading retail chain in Indian market. A lot has been said about possible loss of potential job and infrastructure development due to this.Besides that the suggested provision of sourcing from local SMEs is also proving to be a deterrent. IN DIA AND THE INTERNATIONAL MARKET The graph below shows India’s status wiz a wiz status of organized retail in other countries. It can be observed that India still has a long way to go if it wants to increase the share of organized retail in the retail market. Figure: Organized retail as a percentage of total retail in different countries Source: CRISIL In the second half of the 20th century, many countries opened up there markets for Organized Retail and some also opened for multi-brand retail.There were some countries who felt a positive impact of the same, China is one such example; while there were others such as Uk which were adversely affected. India should also proceed with implementing FDI in multi-brand retail in phases, looking for any drawbacks, before it opens up fully. REFERENCES CRISIL Research, http://crisil. com/research/list-of-industries. html# Dun and BradStreet, http://www. dnb. co. in/IndianRetailIndustry/overview. asp Indian retail News, http://www. india retailnews. com/ Tata group official website, http://www. tata. com/company/profile. aspx? ectid=oH90Rc8X7Dg= Croma retail, http://www. cromaretail. com/ FDI in Retail, http://cci. gov. in/images/media/ResearchReports/FDI%20in%20Indian%20Retail%20Sector%20Analysis%20of%20Competition%20in%20Agri-Food%20Sector. pdf Futures group Official website, http://futuresgroup. com/ BIBLIOGAPHY Economics by Samuelson and Nordhaus ——————————————– [ 1 ]. Lifestyle formats include departmental stores and specialty stores [ 2 ]. Value formats include supermarkets and hypermarkets [ 3 ]. Retailers can use price differentiation to gain from the consumer surplus [ 4 ].Private  labels or private  brands  Ã‚  are the brands that are owned and sold by  Ã‚  retailers at their stores   and are typically  priced lower  (5-15 percent)   as compared to  the existing  brands. [ 5 ]. These factors will result in a shift of demand curve to the right [ 6 ]. Source: CRISIL [ 7 ]. Organised retail penetration expected to cross 10 per cent by 2016-17 [ 8 ]. In such cities, the number of market players is very large forming a monopolistic market, brand positioning thus becomes very important to create great brand recall value. [ 9 ]. Unique Selling Proposition [ 10 ]. Opened up multi brand retail in phases.

Thursday, August 29, 2019

The Classroom Plan Essay Example | Topics and Well Written Essays - 1750 words

The Classroom Plan - Essay Example As I have grown and become a mother, my philosophy on children, how they learn and grow has evolved. Personally, I have witnessed my children grow stage by stage and what each stage entailed in their development. It is amazing how one moves from one stage to another. Physically, it is obvious, but cognitively, it takes a while to realize that they grow out from being babies sooner than I expect. I believe that there are certain skills that develop per stage and that they learn from developmentally-appropriate activities before they can progress to another level. I have also learned that children are capable of learning if they are just trusted enough to be let go to explore and discover things for themselves and even solve simple problems on their own. In allowing them such, it communicates to them is respect for their own learning styles. An educational approach that adheres to a constructivist philosophy, is usually based on the theories of Piaget or Vygotsky. A Piagetian-based classroom promotes discovery learning, sensitivity to childrens readiness to learn, and acceptance of individual differences (Berk, 2008). A Vygotskian-based classroom on the other hand, emphasizes assisted discovery, in which both teacher guidance and peer collaboration are virtually important (Berk, 2008). Taken together, both will highly benefit the preschool child. I also subscribe to Howard Gardner’s (1983) Multiple Intelligence theory. It has motivated educators and ordinary people to think that each person has a giftedness that makes him special in his own way. Gardner claims that intelligence is not limited to the cognitive domain, as traditionally conceptualized. He views it in a much broader sense to include the individual’s affective, social and creative domains. He has come up with a number of intelligences a person possesses within him, as

Wednesday, August 28, 2019

Analysis of a doll's house Essay Example | Topics and Well Written Essays - 750 words

Analysis of a doll's house - Essay Example The thesis statement is that: â€Å"A Doll’s House† emphasizes upon self-actualization and independence of choice, for all human beings and not just women, especially when it comes to the bond of marriage. This paper is an analysis of the play. The world took Nora as a hardcore feminist who slams the door upon a man, revealing the fact that a woman can do much more than just running the house and bearing children. This feministic view was quite alien to the Victorian era people, who kept themselves from discussing the play at gatherings due to its controversies. Ibsen was criticized as writing plays intended to destabilize the society and the bond of marriage. He was considered as a challenger of societal norms and traditional values. However, he did not accept the title of a feminist; rather, he called himself a humanist. He emphasized upon the fact the human rights must be respected, by giving every individual the chance and choice to live a life of his own, rather th an staying tied to bonds that he can hardly spend his life with. He made Nora leave Torvald, not because he favored women, but because he favored humanity and liberalism. Through his play, he encouraged people to stand up for their rights, against those who did not deserve to be done good to. For him, it was a matter of human rights, and not of women rights. He used women to express how humanity was being repressed, because normally women are the repressed ones in our society. Hence, a shadow of feminism is there, which cannot be denied. We come to know this when Mrs. Linde says, â€Å"I only feel my life unspeakably empty. No one to live for anymore†¦Ã¢â‚¬  (Ibsen 19), which shows how she lived life serving others and not herself. An example of male chauvinism comes when we hear Torvald say to Nora, â€Å"I shall not allow you to bring up the children: I dare not trust them to you† (Ibsen 107), which shows how man can demean a woman by being able to snatch from her mo st basic right. The play shows the couple leading themselves to the dissolution of their marriage, because they were not able to understand the status of one another. For Ibsen, a marriage is successful if the two spouses come to join one another on an equal level. The couple must understand that none of the two is supposed to be dominant or recessive. The disparity of power leads to problems and misunderstandings. Torvald has been shown as a dominant, providing husband; while, Nora is a recessive wife who dreads the disclosure of her crime over her husband, like when she says, â€Å"†¦how painful and humiliating it would be for Torvald, with his manly independence, to know that he owed me anything. It would upset our mutual relations altogether †¦Ã¢â‚¬  (Ibsen 23-24). She gets blackmailed by Krogstad. Torvald treats his wife as an inferior being, by calling her by pet names, as he says, â€Å"Is it my little squirrel bustling about?† (Ibsen 8). So, we see that th ere was no equality between the two spouses, which gave rise to misunderstanding between the two, so much so that the wife preferred to leave the husband instead of living with him anymore. Hence, Ibsen has, through his play, been able to provoke a thought among the people around him, regarding the humiliation of mankind and the violation of human rights. He has been able to give a strong meaning to the institution of marriage, where both the spouses are supposed to live together on

Tuesday, August 27, 2019

Atrial Fibrillation Essay Example | Topics and Well Written Essays - 500 words

Atrial Fibrillation - Essay Example AF may occur in men or women and is generally seen in the elderly population in the age group of 60 -70 years or above. As Kowey and Naccarelli points out â€Å"from an epidemiological standpoint AF is predominantly a disease of elderly individuals with cardiovascular diseases† (Kowey and Naccarelli, p.1). AF generally is not seen in the young population. The human heart consists of four chambers – the upper two chambers are known as atria while the two lower ones are known as ventricles. De-oxygenated blood containing high amounts of carbon dioxide enters the right atrium via the superior vena cava and inferior vena cava and flows into the right ventricle. The right atrium contracts to pump the rest of the blood into the right ventricle which in turn contracts to pump the blood into the lungs where the blood loses its carbon dioxide and gets fresh oxygen supply. This oxygenated blood then enters the left atrium which contracts to pump the blood into left ventricle. The left ventricle contracts to send the blood to the rest of the body. These contractions of the heart muscles occur due to an inbuilt electric supply system present in the human heart that sends out electrical signals during each heart beat. Each electrical signal starts its journey from the sino-atrial (SA) node present in the right atrium of the heart. From her e as it moves down it causes both the atria to contract thus pumping blood to the ventricles. The electrical signal then moves down to the atrio-ventricular node and via the bundle of His enter both the ventricles causing them to contract and pump blood to the lungs and the rest of the body. In atrial fibrillation this electrical signal arises from the nearby pulmonary veins and other parts of the right atrium instead of the SA node. These electrical signals produced are extremely irregular and generally very rapid and can range up to 350 signals per

Monday, August 26, 2019

Use of Music in Marketing Essay Example | Topics and Well Written Essays - 2500 words

Use of Music in Marketing - Essay Example This essay "Use of music in marketing" outlines the role of music in the advertising. The music creates the association between sound and product's image in the consumers' minds. People buying certain brand in the XXI century do not need just a brand, they also want emotional connection with it and they want to make sure that this brand will speak of them to other people. And emotional feedback from the act of purchase is possible only when the advertisement has created buzz and excitement in advance. So commercials with the right music can guarantee three important things to consumers: identity with the product, engagement, and currency of the marketing situation. Music can be that last step helping the brand to draw attention of the customers and stick in their memory. Moreover, with the help of music it is possible to provide consumers with the content to examine and share (Olenski, 2014). Whenever there are emotions involved people start speaking about artistic approach. That is how choosing the right music has become a special kind of art in marketing. Music as a universal language can speak to all layers of the audience and be understood without words. Music instantly gives a full of scope of information about the main characteristics of the product: for example, if a company is launching a completely new product they may introduce a fresh band in their commercial to be associated with coolness and innovations. Music appeals to a more profound level of information processing-emotions.

Sunday, August 25, 2019

Research paper Example | Topics and Well Written Essays - 1000 words - 10

Research Paper Example India’s involvement in space programs can be traced at the beginning of 1960s. Actually, it was just in 1962 that the authority that would control the relevant science projects established in India: reference is made to the ‘Indian National Committee for Space Research’ (Moltz 114). Since then, the country’s missions to space have been related to a particular target: to secure the social and economic environment of the country (Sadeh 303). More specifically, the space program of India has been based on ‘the needs of man and society’ (Moltz 114). However, if reviewed carefully, the particular program is proved as being far from its initial mission. One of the most important issues that should be taken into consideration when developing a space program is the program’s financing needs. In the case of India, this rule had not been followed. According to Sadeh (11) the gaps between the estimated cost of a space program and its final cost is a common problem in the specific sector. For this reason, the government of a country involved in such project needs to locate in advance potential sources of funds that could be used when the project would exceed its budget (Sadeh 11). In the case study it is explained that the cost of the whole project reached the level of $70m (page study, p.1), an amount that it is considered as extremely high if taking into consideration the current status of Indian economy. The review of the historical development of India’s space program shows that there has been no provision for covering extra costs during the project’s life cycle (Sadeh 303). On the other hand, the threat from neigbouring countries, especially of China, is often used as an argument for justifying India’s space program (Harding 107). According to the case study, India’s mission to Mars has been decided not so much for gathering information in regard to the planet’s ground and environment bu t mostly in order to verify the country’s technological advances especially compared to its key rival, i.e. China (page study, p.1). Of course, the potential use of space technology for securing the country’s safety in terms of national security cannot be ignored. However, such target would be in opposition with the program’s initial mission, i.e. to respond to the needs of the country’s social and economic environment (Sadeh 303). In other words, a contradiction appears between the targets on which the establishment of the program was based and the targets that appear today as the program’s priorities, such as the increase of India’s military strength towards its rivals, or the improvement of the country’s position in geo-political terms. The inappropriateness of India’s space mission, at least in regard to the current period of time, is also proved through the following facts: A) The status of India’s current infrastru cture seems to be quite low. In fact, it was a few days before the mission to Mars that due to severe damages the country’s power supply units stopped their operations; even if the problem caused by the weather the extension of the damage, about 825 electric poles had to be replaced, reveals the weakness of the country in maintaining its vital infrastructure (Salomi 2013). At this point, the following question appears: how the country could support a mission to space while facing such problems in regard to its energy infrastructure is a question that cannot be easily

Saturday, August 24, 2019

The American Declaration of Independence Essay Example | Topics and Well Written Essays - 1750 words

The American Declaration of Independence - Essay Example The signers concluded that the colonies must then break political ties with the British Crown and become "independent states with full power to levy war, conclude peace, contract alliances, establish commerce" among others and that, representing every colony, they pledge "to stand by the Declaration with their lives, fortunes, and honor." The independence of these American colonies was however recognized by Great Britain only on September 3, 1783, by the Treaty of Paris (Wikipedia 2005). Leading Writers. According to Ingersoll (1856), the literature of American liberties was first edited by written constitutions of Virginia and North Carolina, who first seceded from the union, followed by Massachusetts or other States. As originators working not only for independence but for larger liberties, slave-holders took the lead. "Slave-holders in the undisturbed meditation of plantation life, with frequent transactions in State representations, were the two principal founders of American free government," he said. Ingersoll (1856) further said "every bill of rights and written constitution came first from the slave-holders; every American founder of American liberty had been a slave-holder." American bondman. Frederick Douglass, American bondman, was invited to give a speech in Rochester. He gave a scathing one on Americans celebrating their freedom day on the fourth of July while in their hypocrisy kept nearly four million humans as slaves. Speaking on the subject of "American slavery," he says he does not hesitate to declare, being identified with the American bondman, that the character of America never looked blacker to him than this Fourth of July" (Douglass, 1852). While they listened, he continues with rage - "Would you have me argue that man is entitled to liberty That he is the rightful owner of his own body You have already declared it. Must I argue the wrongfulness of slavery Is that a question for Republicans Is it to be settled by the rules of logic and argumentation, as a matter beset with great difficulty, involving a doubtful application of the principle of justice, hard to understand How should I look today in the presence of Americans, dividing and subdividing a discourse, to show that men have a natural right to freedom, speaking of it relatively and positively, negatively and affirmatively To do so would be to make myself ridiculous, and to offer an insult to your understanding. There is not a man beneath the canopy of heaven who does not know that slavery is wrong for him" (Ibid). Historian interviews. Horton (2001) who had interviewed several sectors of southern states says withdrawal from the United States of these colonies was "directly connected to the protection and preservation of their institution of slavery." Those in power in the south, he said, understood it as such. For example, he said, Georgian Governor Joseph Brown explained that Georgia seceded (just after South Carolina), considering that Lincoln was "a mere instrument of the

Friday, August 23, 2019

Technological Achievements that Led to FISMA and COPPA Essay

Technological Achievements that Led to FISMA and COPPA - Essay Example This can be seen clearly from the enactment of various legislations that are aimed at protecting security and privacy such as the Federal Information Systems Management Act (2002) and the Children’s Online Privacy protection act (1998). FISMA and technological advancement leading to its creation FISMA in general aims at mandating basic security standards for government information technology systems. It requires that government agencies detect and report security vulnerabilities in computer systems. It also requires of them to improve the information security framework that is the plan of how they will improve the networks and finally the act includes a set of directives that govern agencies’ security responsibilities and how to adhere to the law (NIST, 2002). There are a few advances in information technology that resulted in the formation of this act. The first advancement is the move from mainframe computers to networked computing. The mainframes were originally larg e machines used for processing data by the federal government. Most of these were stand alone and therefore the risk of accessing information was greatly reduced. The move to networked computing where agencies could share information over a network increased the risk of exposing information to unauthorized persons. Secondly it also increased the chances of the computers being hacked into and data being used for malicious purposes. These advancements therefore led to ethical issues such as privacy and security concerns that had to be addressed necessitating the creation of this act (Dark, 2010). The second advancement was the move from the networked machines between government agencies to the internet. Networked computing enabled agencies to share information whereas the internet enabled agencies and individuals to access basic services online without having to go to the government offices. With this move privacy and security concerns increased as government departments became prone to cybercrimes such as the hacking of websites and this meant someone could hack into a government website, modify information or even collect information from citizens and use it for malicious purposes. Such necessitated regulations to be enacted to ensure that government information as well as individual privacy is protected (Dark, 2010). COPPA and technological advancements leading to its creation The second act, the COPPA act in general aims to give parents the control over what information is gathered from their children who are below the age of 13 online. The dynamic nature of the internet necessitated the creation of this act which applies to operators of commercial websites and online services that collect make use of or disclose personal information from children under the age of 13.it is also directed at operators of general audience websites and online services that know they are collecting, making use of or disclosing information that is of personal nature from children under the age of 13. It requires operators to issue comprehensive privacy policies, provide parents with notices for consent, provide parents access to information collected from children, give parents authority to prevent further use of internet and ensure confidentiality security and the integrity of information they have

Thursday, August 22, 2019

Case study Example | Topics and Well Written Essays - 250 words - 21

Case Study Example 3.2 The factors that are identified by ATK while constructing the flight risk model include the age and the tenure of the employee in the organization, his marital status and the complexities of this work, relation with the other employees included in the flight risk model, any change seen in the issues that were related with benefits and seasonality. Of these factors, changes seen in the issues that provide the benefits and complexities of the work level contributed the maximum for increased turnover while marital status seemed to be the least important for voluntary turnover for the employees. 3.5 The statistical model introduced in NASA and ATK for calculating the employee turnover might have benefitted the employees there buy it is not necessary the model would do the same for other companies too. The model brought information more about the employees who were found in the bottom lines jobs. There was no information about the other employees in the hierarchy. Besides, there were less analytical skill sets in the model which would be necessary while understanding the work climate in an

Physical Therapy Essay Example for Free

Physical Therapy Essay The major that I will be going into in the next four years is Physical Therapy. Physical Therapy is basically a health care profession, that provides therapy for those who have been injured, have a physical disability or for those who are experiencing minor pains in their body. I chose to get into Physical Therapy for many different reasons. I first thought of being a Physical Therapist when I realized that I was a hands on type of person, meaning that I like to work while being active. I then discovered that a lot of Physical Therapists work for college and professional sport teams and that to me was very exciting considering I want to play in the NFL one day. For the past year I have been interested in becoming a Physical Therapist. Everyone that I have talked to about my decision on choosing this field has been very supportive and has said that it is perfect for me. There are many different courses you must take to become a Physical Therapist such as, Biology, health sciences, kinesiology and ATC. Hearing from past students that were involved in the Physical Therapy field, they have told me that it takes a lot of hard work to really advance in the field. A major assignment when you’re entering the Physical Therapy field is learning the human body and a project that involves learning the human body is having to observe a diseased body. This project will benefit me in the field because it gives me a broad look on the way the human body is and looks inside. Being that you have to know the muscular system and the skeletal system, observing a body will let you take a deeper look into how the body looks and will teach you everything you need to know when you’re working with a live person. Being a Physical Therapist has really advanced throughout the years and therapists have now been considered doctors. Being a doctor is a very difficult thing to do, having to get your masters and then your working for your doctorates degree requires a lot of time and a lot of work. Being a Physical Therapist depending on how sophisticated you get, can bring in a lot of money. Also it can open up a lot of job opportunities. Whether you choose to work for a team or work for an office, you can eventually open up your own business with the right level of education. Another positive thing about Being a Physical Therapist is that you know how to treat injured people, so god forbid someone in your family gets injured you can treat them without orrying about some other person making things worse. A negative part about being in this field is that it will take up a lot of your time either at school or when you’re actually working. If you’re getting involved with a professional team then you also have to consider the traveling part of the business, going from state to state every week during the season. Also it will require a lot of money to go far into your major. College will give me the resources and the knowledge that I need to know in order to do well with patients. You must have a masters or doctorate degree to become a physical therapist. A recent study has shown that about there was about 199,000 jobs in the US for being a Physical Therapist. Athletic Training is a career that is very similar to Physical Therapy and both degrees can be used for each other. The average Physical Therapist gets paid about 78,000 dollars a year.

Wednesday, August 21, 2019

Compare The Immigration Policies In Two Countries History Essay

Compare The Immigration Policies In Two Countries History Essay Australia and America during the White Australia Policy period 1901 1973; Comparisons, Consequences the Future When comparing and contrasting the factors that shaped the immigration policies of the United States and Australia during the White Australia period of 1901-1973 it is apparent that there are some strong similarities in the policies, particularly in the areas of politics and economics. There are also defining differences in the contributing cultural factors with regard to the types of nationalism and identity that emerged within the two countries. Whilst both countries were immigrant nations, Australia has held on to its British heritage, whereas the United States had become a world power in its own right even before the British Empire fell. The vast size of the United States population has also played an immense role in its place in the global world of leading nations. Although the two nations are similar in geographical size, by 1901 the population of the United States was twenty times that of Australia (Aust. Beaureau of Statistics 2002 U.S. Bureau of the Census 1999). The enormi ty of the US made it less concerned than Australia about fears of attack, or being swamped by immigrants (Freeman Jupp, 1992, Preface). These factors have all contributed in some way to the diversity in the ethnicity of immigrants who settled in the respective nations. Similarly the reasons behind why they chose one country over another, were allowed into one country over another, or in the case of Australia, were coerced into migrating to a foreign nation by means of free passage, must be considered. The similarities and differences in the immigration policies of these two countries will be discussed and compared throughout this research essay with the aim to focus on how these factors have contributed to current migrant populations and immigration polices within a global context. The initial immigration policies of both Australia and the United States shared many common factors and some differences. In the United States the San Francisco Gold Rush began during 1848. Many Mexicans and South Americans migrated to the region at this time to labor as miners. Initially the levels of Chinese migration as gold diggers was relatively low; it was not until 1852 that the numbers began to rise and by 1860 California had a total Chinese population of approximately 35,000 (Markus, 1979, pg.1). The levels of Chinese people arriving became so high that accommodation sources were completely depleted and tents were pitched on the streets. From an economic perspective, fears began to rise that the mines were going to be fully overtaken by these migrants and the US miners began to retaliate, The War upon the Chinese began (Markus 1979, pg.4). Daily expulsions began to take place with US miners demolishing Chinese tents and claims and mining codes were introduced that prevented Chinese from mining in certain districts. The Chinese were physically chased from claims and mining districts and murders were reported but rarely, if at all, were followed up by officials with no apprehension or punishment of offenders (Markus 1979, pg.6-7). Similarly, in Australia, the discovery of Gold near Bathurst in 1851 was the initial instigator for mass migration changes. Prior to this, migrants had been primarily convicts from Britain and Ireland. During the Gold Rush migrants began pouring into Australia from wide and varied backgrounds. Between 1851 and 1861 over 600,000 people migrated to Australia (Migration Heritage Website, 2001). Whilst the vast majority were still from Britain and Ireland, immigrant levels from countries such as Europe, China, the United States, New Zealand and the South Pacific began to rise (Migration Heritage Website, 2001). One of the largest migration groups were the Chinese, who with time, were seen by the Australian population as a financial threat to society, just as they were in the United States. In both cases the number of Chinese migrants grew whilst gold yields slumped. However, unlike America , this economic concern introduced a change in culture in Australia , with racial aggression toward s the Chinese due to their differences in appearance, customs and culture. In a nation looking towards maintaining its British white Australia policy these clashes were a major reason for the implementation of the Immigration Restriction Act at the time of Federation in 1901. Therefore, for both Australia and the US, Asian immigration caused the introduction of exclusionary policies. The White Australia Policy of 1901 effectively banned Asian immigration to Australia for the next fifty years (Migration Heritage Website, 2001). Similarly, in the US the Chinese Exclusion Act passed by President Chester Arthur in 1882 prevented immigration of the Chinese for ten years. This act was later extended for another ten years and became permanent in 1902 (Harvard University Library website, 2006). Interestingly, although the US did not make the Chinese Exclusion Act permanent until 1902, Australian legislators used this act as a model when developing the Immigration Act of 1901 (White Australia Policy), after considering the problems they saw occurring in the US during the Gold Rush years (Markus 1979, Intro pg.xiv). In Australia, unlike the US, the main complaints against the Chinese were initially economic but rapidly became cultural and political. The economic concerns began with claims predominately relating to the idea that Chinese were taking the gold that rightfully belonged to the homeland. Whilst Australia had initially tolerated early Chinese immigration under the hope that they would provide cheap labor, boosting the economic working population and opening the Northern parts of Australia to settlement (Markus 1979, pg. 20), this early tolerance did not take long to fade. Miners and the Australian general population began to take offense not only to the working habits of the Chinese, their so called clanning which gave them the advantage of working in large numbers and monopolising diggings, but also to their mannerisms, customs, religion and colour (Markus 1979, pg. 21). Although these factors also played a role in the US reaction to Chinese immigrants, it was not quite so significant in the racial sense, as it was in Australia. Hence, Australia put into place its White Australia Policy, specifically aimed at excluding Asians, and later, non-desirable Europeans, whilst the US initially aimed their immigration policies predominantly at culling the amount of migrants from anywhere to their country. The Chinese Exclusion Act of 1902 preceded the US immigration restriction acts of the 1920s, which eventuated in the National Origins Act of 1929, capping the overall immigration allowance to the US at 150,000 and completely prohibiting Asian immigration (Harvard University Library website, 2006). World War I brought another change to the US immigration policies which had repercussions for Australia. In Australia when the First World War broke out in 1914, migration almost ceased altogether. Migrants from some countries previously thought of as acceptable were now classified as enemy aliens (Migration Heritage Website, 2001). Germans, Austro-Hungarians, Bulgarians and Turkish immigrants faced internment in Australia or general restrictions on their daily lives. Altogether, about 7000 people were interned in camps in New Sout Wales. This happened again during the Second World War with Germans, Italians, Japanese, Hungarians and Jewish refugees being interned. No preference was given on the basis of refugee status or political sympathies to the Jewish migrants. (Migration Heritage Website, 2001). In comparison, United States immigration between 1901 1973 can be categorized into three eras; The New Immigration 1890 1930, The Depression War 1930 1965 and Third World Immigratio ns 1965 onwards (Judd Freeman, 1992, pg 9). During the New Immigration unprecedented amounts of immigrants landed on American shores. Most of these were young and predominantly male, providing laborers to work within the industrial uprising (Judd Freeman, 1992, pg 9). However, after the First World War the United States wanted to limit the amount of the no longer acceptable Europeans, particularly Southern Europeans, migrating to their nation. In turn this caused increasing numbers of young Greek and Italian men to pay their way instead to Australia (as just discussed). This knock on effect resulted in Australia implementing strict quota restrictions on these men (Judd Freeman, 1992, pg. 4). These migrants were escaping religious, racial, and political persecution, or seeking relief from a lack of economic opportunity or famine (Eyewitness to History website, 2000). We can see here the correlation between the two countries and the consequences that the United States immigration r estrictions had on Australian policy makers, encouraging them to adopt racially discriminative immigration legislation. In Australia, Post World War II and on into the 1950s and 60s Europeans continued to be granted immigration status, with the focus being greatly based on the populate or perish idea and assimilation into Australian society and culture. Immigrants were expected to shed their existing cultural identities, including their native languages, to promote their rapid absorption into the host population (DFAT website, nd). Although Australia in theory needed and encouraged these migrants in order to increase the population through means of government work placement agreements, the conditions they were subject to on arrival were quite appalling. Most migrants arrived by ship, from where they were immediately taken to hostels for migrants that had been set up in rural areas. The conditions were often very primitive, with men and woman separated into single sex barracks, shared bathrooms and communal kitchens and dining rooms serving unfamiliar foods. The situation was not welcoming and there wa s an expectation that a migrant would need only four to six weeks in one of these hostels before being prepared to settle near their new (enforced) workplace. It was not until 1969 that family units opened at the Villawood migration centre in New South Wales (Migration Heritage Website, 2001). On the contrary in the US things were very different. As they had no need to populate their already vastly inhabited nation, migration policy was largely prohibitive. From the 1930s right through until 1965 when the Immigration Nationality Amendments Act was passed, immigration was on the decline in the US. As a result of this, coupled with the fact that existing migrants were ageing, specific assimilation policies were not implemented. The emphasis was very much on Americanization and the melting pot theory without an actual government act required (Judd Freeman, 1992, pg.8). With the passing of the Immigration Amendments Act this all changed. The Third World immigration period began, bringing with it a new wave of immigrants, differing from those who had arrived before. The new law set an overall limit on immigration from the eastern hemisphere countries and capped, for the first time, entries from the west. Family reunification was emphasized and refugee law was introduced (Free man Jupp, 1992, pg.9). This Immigration Amendments Act reflected the civil rights movement taking place in the US, along with a movement toward the establishment of good foreign relations with an economically rising Asia. As this new wave of migrants was hitting America, Australia also began to experience significant changes. It was recognized that immigrants could not be forced to become the New Australians(Freeman Jupp, 1992, p.184) when there were obvious, governmentally imposed, employment and social segregations for these new arrivals. Migrants were living, as a result of these segregations, in isolation and relative poverty(Freeman Jupp, 1992, p.184). Children were failing at school, only basic low paid employment was available for people with poor English speaking skills, and the local Australians avoided contact with these people who were supposed to be assimilating into their society. Between 1965 and 1972 an Integration Branch was implemented into the Department of Immigration (Freeman Jupp, 1992, p.186) which was a means to assist migrants in as many aspects of their new Australian life as possible. It was a first attempt to make life easier for them, with English language schooling, wel fare services, workplace teachings, etc. By 1972 the government had recognised that the migrant population in Australia formed a large part of society that deserved to be recognized and have their needs met. In 1973 Gough Whitlam abolished the White Australia Policy completely. In a comparison of both Australian and American immigration history, it can be seen that whilst some issues were relatively similar or related, as noted above, that these two countries are actually very different in terms of migration. Many correlations can be drawn globally between the two nations, such as being English speaking, settler societies, or countries of immigrants, but the reasons behind their migration trends in most instances is completely different. Whilst Australias early, and most significant immigration population initially came from Britain, based on ethnic ties with the home country and Australias need for population, Americas first immigrants were volunteer migrants heading to a new land for a better life. The similarities in the policies that both nations have adopted over time, is that they have caused a type of cultural pluralism (Ucarer Puchala, 1997, pg.341). In theory this means that all racial, religious and cultural groups are tolerated within one societ y. On the surface of both countries this is true. Blacks and whites work together, there are interracial marriages, everyone can vote and society does usually operate in a suitable manner. It is the problems under the surface of a long history of underlying racial tension that need to be addressed. These racial tensions essentially exist, not because of the immigration policies alone, but of how they were implemented into society for both locals and migrants. Emigration throughout history results from people around the world searching for human security, whether it is economic, social, political or cultural, the search continues (Ucarer Puchala, 1997, pg.342). A possible global solution for nations, such as Australia and the United States, who are trying to control and contain the flow of migration, would be to consider the adverse conditions that people are looking to escape and implement foreign policy to begin to change and assist with these problems. Although these types of pol icies would take a great deal of time to implement, it seems worth considering as a plausible and humanitarian option rather than simply working to establish policies that are aimed at keeping prospective migrants out as per the existing legislation in both countries.

Tuesday, August 20, 2019

A Silent Mutation With Unknown Mechanism Biology Essay

A Silent Mutation With Unknown Mechanism Biology Essay A silent mutation with unknown mechanism of C1311T in exon 11 combined with IVS11 T93C (G6PD 1311/93) has been reported in G6PD deficient individuals in many populations. In our previous study, G6PD 1311/93 was identified as the common G6PD variant in one of the Malaysian aboriginal groups. Here, we report the screening for this variant via PCR-RFLP method and then direct sequencing of the entire 3 ´UTR of the G6PD gene in 175 aboriginal volunteers and 45 non-aboriginals. In the aboriginal group, 72 individuals (41%) carried the G6PD 1311/93 while 6 individuals (13%) were identified in the non-aboriginal set. Three novel SNPs, ss218178027 (+272 G/A), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) were discovered in 3 ´UTR. SNP ss218178024, which is located inside an AG-rich region, has shown a significant association with G6PD 1311/93 as it was observed solely in individuals with G6PD 1311/93. Computational analyses indicated that three miRNAs have potential to bind to the reg ions encompassing ss218178024. Whilst transitions of A to G dose not destroy these miRNA target sites, it extensively alters the mRNA secondary structure and creates a putative hsa-miR-877* binding site. Notably, ss218178027 and ss218178028 do not change mRNA secondary structure. It could be speculated that ss218178024 have a potential functional effect on the down-regulation of mRNA and consequently G6PD deficiency either by affecting mRNA secondary structure or mirRNA regulation process. This is the first report of clinical association of a SNP in 3 ´UTR of G6PD mRNA. Genetic variations in the G6PD gene are responsible for G6PD deficiency in humans. More than 140 ethnic reliant nucleotide variations in the G6PD gene have been reported (Nkhoma et al 2009). Most of these variants are single missense mutations, with the rest being either double or triple missense mutations or small in frame deletions (Cappellini, G Fiorelli 2008). All these mutations alter the protein sequence of the G6PD enzyme by either amino acid substitution except for a silent mutation of C1311T in exon 11 combined with IVS11T93C (designated here as G6PD 1311/93). This genotype has been reported in G6PD deficient individuals in different ethnic populations with different frequency (Vulliamy et al. 1991; 2000; Jiang et al. 2006; Daoud et al. 2008; Jalloh et al. 2008; Wang et al. 2008; Moiz et al. 2009 ). This combination is a special G6PD variant where the carrier is deficient without any changes to the protein sequence of the G6PD enzyme. From previous studies, association of th ese two has been shown as significant in reducing G6PD enzyme activity in some individuals and hence has clinical implications (Yu et al 2004; Wang et al 2008; Jiang et al 2006). It is notable that some of the individuals with G6PD 1311/93 presented with normal G6PD activity (Jiang et al 2006). Bearing in mind, it is reasonable to postulate that other change(s) in the G6PD gene with potential linkage disequilibrium by this combination is responsible for the enzyme deficiency. Importance of 3 ´UTR of human genes in the post-transcriptional regulation has been supported by finding of functional SNPs in the 3 ´UTR of a number of genes (ref). In the other word, genetic variations in the 3 ´UTR of some genes are associated with variety of human disease ( ref ). Cis-acting elements in the 3 ´UTR of human genes are key players in controlling of mRNA stability, localization and level of translation (ref). Conversely, according to a recent systematic search, 106 conserved motifs located in the 3 ´UTR of human gene are associated with post-transcriptional regulation which half of them likely are miRNA binding sites (Xie et al 2005). MicroRNAs (miRNAs) are a class of genes encoding short RNAs, which are known to inhibit gene expression by binding to the 3 ´UTR of the target transcript. Notably, miRNAs are predicted to regulate about 30% of all human genes by targeting sequences in their 3 ´UTR (ref) . Noteworthy, several SNPs inside the miRNA gene and the miRNA binding sites have been identified recently (ref). The associations of these SNPs with some disease like Parkinson and some kind of cancer have been documented (Sethupathy 2008; Shen 2008). Given that, in the present study, we sought to determine if any SNP in the 3 ´UTR of G6PD gene in G6PD 1311/93 is involve in the regulation of mRNA processing. Subjects and Methods This study was approved by the University Kebangsaan Malaysia (UKM) hospitals ethics committee. All subjects gave their written informed consent. In our previous study, we attempted to identify the molecular basis of G6PD deficiency in 25 deficient individuals from one of the Malaysia aborigine group, namely, the Negrito (data in press). Our earlier results showed that G6PD 1311/93 is the commonest G6PD variant in Negrito. No other mutations were detected in the remaining exons or adjacent regions of the G6PD gene for subjects with G6PD 1311/93. In the present study, blood was collected from 175 consenting volunteers from four sub-ethnic groups of Negrito namely Kintak, Lanoh, Jahai, and Bateq. A series of 45 non-aboriginal volunteers were selected as the reference group. Genomic DNA was extracted by using the Salting Out method (ref). The oligonucleotides used as primers were either designed by online primer-BLAST program or obtained from published data (Kurdi-Haidar et al. 1990). The G6PD gene sequence was obtained from NCBI (reference sequence NC_000023.9). Sequence of each exon was obtained from ENSEMBL (Transcript ENST000 00393562). Then two regions of the G6PD gene (region ab and cd in figure 1) were amplified using the PCR technique to detect variation in nt 1311 in exon 11and nt 93 in intron 11. A proportion of the PCR product from regions ab (207 bp) and cd (317 bp) were digested with the appropriate restriction enzyme according to the manufacturers instructions (New England Biolabs) and then run on 3% agarose gels, stained with ethidium bromide, and photographed under UV light. Region ab was digested with BclI and region cd was digested with NlaIII. For all samples, PCR direct sequencing was performed for 3 ´ UTR of G6PD gene by using 2 sets primer of ef (320 bp) and gh (397 bp). Figure 1: Schematic map of part of G6PD gene (exon 10 to exon 13). The arrows point to the positions of each primer site. Oligonucleotides a: 5 AAGACGTCCAGGATGAGGTGATC 3 and b: 5 TGTTCTTCAACCCCG AGGAGT 3 are the primers used to detect 1311 C>T transition. Oligonucleotides c: 5 TGGCATCAGCAAGACACTCTCTC 3 and d: 5 CCCTTTCCTCACCTG CCATAAA3 are the primers used to detect IVS11 nt93 T>C. Oligonucleotides e: 5 GAGCCCTGG GCACCCACCTC 3 and f : 5 TCTGTTGGGCTGGAGTGA 3 were amplified part of 3UTR and oligonucleotides g (5TCACTCCAGCCCAACAGA3) and h (5 GGTCCTCAG GGAAGCAAA 3) were amplified the rest of 3UTR of G6PD gene for sequencing. Bioinformatic Tools We used two computational tools for each section to confirm our results. F-SNP (http://compbio.cs. queensu.ca/F-SNP/) (Lee Shatkay 2008) and FASTSNP (http://fastsnp.ibms.sinica.edu.tw) (Yuan et al. 2006) was used to find putative functional SNP in 3 ´UTR of G6PD gene. The RegRNA program (http://regrna.mbc.nctu.edu.tw/) (Huang et al. 2006) and MicroInspector (http://bioinfo. uni-plovdiv.bg/microinspector/) (Rusinov et al. 2005) was utilized to identify the miRNAs binding sites inside 3 ´UTR of G6PD gene. Secondary structures of the full-length of G6PD mRNA and as well, 3 ´UTR was predicted using GeneBee (http://www.genebee.msu.su/genebee.html) and mFold (http://mobyle.pasteur.fr/cgi-bin/portal.py) (Zuker et al. 1999). The program RNAhybrid (http://bibiserv. techfak.uni-bielefeld.de/cgi-bin/rnafold_submit) (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum free energy hybridisation of mRNA and miRNA. Results Genotyping DNA from 175 aboriginals and 45 non-aboriginals were screened for presence of G6PD 1311/93. In overall 72 aboriginal individuals (41%) and 6 non-aboriginal subjects (13%) carried this combination (table 1). Through direct sequencing of DNA fragments, three novel SNPs, of ss218178027 (+272 A/G), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) was found (Figure 2). SNP ss218178027 was observed in 6 subjects in aboriginal group with G6PD 1311/93 (table 1) inside of an AG-rich region (AGAAGGAAGGAGGAGG). SNP ss218178028 was observed in 4 aboriginal individuals which 3 of them carried normal alleles in 1311 and 93. None of our non-aboriginal samples carried ss218178027 or ss218178028. SNP ss218178024 also surrounds by other 30 bp AG-rich sequence (gggagggagggacaag ggggaggaaagggg) and it was observed in all those G6PD deficient individuals who carried G6PD 1311/93. In the absence of G6PD 1311/93, ss218178024 was not found. Females who were heterozygote for the G6PD 1311/93 were also heter ozygote for ss218178024. Figure 2. Partial nucleotide sequence of normal, heterozygote and homozygote females respectively for forward strand of ss218178024 (a1, a2, a3), reverse strand of ss218178027 (b1, b2, b3) and reverse strand of ss218178028 (c1, c2,c3). Arrows show position of each SNP. Table 2 SNP Individuals with G6PD 1311/93 individuals normal for G6PD 1311/93 ss218178024 ss218178027 ss218178028 Aboriginal individual 72 105 72 6 4 Non-aboriginal individual 6 37 6 0 0 Bioinformatics Analysis Search for reported SNPs inside of 3 ´UTR of G6PD gene By using F-SNP and FASTSNP programs, we found six SNPs have been reported inside of 3 ´UTR of G6PD gene including SNP ref ID: rs1050831,  rs1050774, rs1050773, rs1050830, rs1063529, rs1050757.  The last one is actually same with ss218178024. All of these known SNPs were discovered via cDNA sequencing and to date no clinical associations have been reported for them. Prediction of putative miRNA binding sites and mRNA secondary structure The wild sequence of 3UTR of G6PD was submitted to regRNA and MicroInspector programs to detect putative miRNAs target sites. The mutant variant of ss218178024, ss218178027 and ss218178028 was also submitted to evaluate effect of each SNP on creating or destroying the miRNAs target sites. However, in silico analysis indicated that three miRNAs have potential to bind to the regions encompassing ss218178024A. Of note, SNP ss218178024 is located inside seed region of these miRNAs which are hsa-mir-204, hsa-mir-211 and has-mir-1249 (figure 3). Moreover, further computational analyses reveal that transition of A to G in SNP ss218178024 creates additional miRNA target site for has- miR-877* which also is located inside seed region. Neither ss218178027 nor ss218178028 is targeted by any miRNA. The RNAhybrid program (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum free energy (MFE) hybridisation of mRNA and each miRNA. Figure 3 The predicted binding site for hsa-mir-211(A), hsa-miR-1249 (B), hsa- mir-204 (C) and hsa-miR-877* (D) at 3 ´UTR of G6PD gene. Perfect Watson-Crick or wobble base pairings between the 5 ´ end of the miRNA and the 3à ¢Ã¢â€š ¬Ã‚ ² UTR target sites was observed. The minimum free energy (kcal/mol) of hybridization is shown in parentheses. Position of ss218178024G is indicated by arrows. Using the program mFold and Genebee, we determined the potential effect of the SNP sequence alterations on RNA folding. As shown in figure 4, ss218178024G is predicted to alter the secondary structure of G6PD mRNA. Also, the free energy of full length mRNA and as well 3UTR predicted to be affected by this substitution. The lower free energy in wild type indicates that mRNA might be more stable in wild type compare with the mutant. In the other word, it is suggesting that altered mRNA is capable to faster degradation. We also submitted the substituted nucleotide sequences of ss218178027A and ss218178028C to the GeenBee and mFold server. No change in the secondary structure of neither full length mRNA nor 3UTR was observed. It might be assuming that ss218178027A and ss218178028C do not probably modify mRNA processing. Consequently, secondary structure of 3 ´UTR of G6PD mRNA has been also checked for the accessibility of miRNA binding site. A stable base-paired duplex observe in the allele A (figure 4a2) and improper binding for allele G (figure 4b2) (arrows show position of changes). Then, it can be assume that miRNAs can be bind to the target site in mRNA due to the accessible site in the substitution of ss218178024G. Genotype Change in secondary structure Change in secondary of full length of mRNA structure of 3 ´UTR 1311T No ss218178024G Yes Yes 1311T+ ss218178024G Yes ss218178027A No No 1311T + ss218178027A No ss218178028T No No 1311T + ss218178028T No Figure 4 Predicted secondary structures of full length wild-type mRNA (A1) and 3 ´UTR (A2) compare with predicted secondary structures of full length mRNA relating to allele 1311T plus ss218178024G (B1) and 3UTR relating to ss218178024G (B2). The free energy (kcal/mol) of the full-length mRNA and 3UTR is shown in parentheses. Statistical Analysis Discussion A recent systematic study of G6PD deficiency indicated a global prevalence of 4.9% with varying frequencies among different ethnicities (Nkhoma et al. 2009). Although comprehensive studies have identified the molecular basis of G6PD deficiency worldwide, some pertinent questions remain to be addressed. For instance, several studies have reported deficient samples with unknown mutation(s) (Ara ´mbula et al. 2000; Nuchprayoon et al. 2008; Barisic 2005; Laosombat 2005; Pietropertosa 2001; Jiang et al. 2006). Additionally, the silent mutation genotype of C1311T in exon 11 combined with IVS11T93C (G6PD 1311/93) does not explain the phenotype of G6PD deficiency in their carriers. Since there are appears to be no clear linkages to known sequence mutations with these examples, factors extrinsic to the G6PD gene sequence information need to be investigated. These factors may include the roles played by mRNA processing, the untranslated regions (UTRs) and regulatory function by miRNAs. To th e best of our knowledge the importance of mRNA processing and regulation by miRNAs has not been extensively studies with regards to G6PD deficiency. The roles of the UTRs of the G6PD gene have also not received much attention. Our literature search revealed two reports which had evaluated the role of the 3 ´UTR of G6PD gene in their respective deficient population and these reports did not reveal any SNP in the 3 ´UTR for G6PD deficient individuals (Nguyen Thi Hue 2009; Karadsheh 2005). Our present study attempts to shed light on the possible role(s) of the 3UTR of mRNA in G6PD deficiency, especially in the case of G6PD 1311/93. The roles in disease phenotypes played by sequence polymorphisms of the 3 ´UTR have been reported (Lambert et al. 2003; Goto et al. 2001; Yang et al. 2007). Here, we present the possibility that the SNP ss218178024 which we have identified in an AG-rich region of the G6PD 3UTR may participate in mRNA processing and can therefore be correlated with G6PD deficiency. There is, however, accumulating evidence on importance of some elements in the 3UTR like AU-rich, C-rich, CU-rich and AG-rich elements relating to mRNA stability by affecting mRNA secondary structure (SS). For instance, functional SNPs were found to occur within AG-rich elements in some genes like Factor VII (Peyvandi et al. 2005), CYP2A6 gene (Wang et al. 2006), PTPN1 (Di Paola et al. 2002) and NPR1 (Knowles et al. 2003). Therefore, to gain further insights into the role of ss218178024 in G6PD deficiency, we have analyzed the SS of both full length mRNA and 3UTR. Significant alteration was predicted in the SS of full len gth mRNA when we submitted the combination of 1311T and ss218178024G. Whilst in the SS of 3UTR, we observed a possible standard Watson-Crick paired duplex in allele A whereas allele G has a reshuffling of the base pairings resulting in a differing SS prediction for the RNA sequence. The role of structure on RNA function is akin to that of protein. Interestingly, SS of the either full length of mRNA or 3UTR including two substitutions of 1311T and ss218178027A or 1311T and ss218178028C was same with the SS of wild mRNA. This data is good in agree with Chen et al. (2006) which reported that non-functional SNPs in a gene usually have same secondary structure, but the functional SNPs usually change the mRNA secondary structure. Consequently, the free energy is affected by base substitution at ss218178024. In thermo stability point of view, the lower free energy (- 661.6 kcal/mol) in the SS of wild mRNA might be result in a more stable mRNA than mRNA with 1311T and ss218178024G. On the o ther view, SS contributes to interaction of regulatory elements with their target sequence in mRNA. In general, when target sequence is part of a stable base-paired with the other sequence of mRNA, the capacity of regulatory elements like miRNA to get involved in translational regulation could be diminished. Similarly, Hew et al. (2000) have been reported that an AG-rich region in elastin mRNA in chicken may affect mRNA stability and they proposed that alteration in SS in this region can affect the accessibility of endogenous RNse to the mRNA. Therefore, we postulated that miRNA binding site likely is not accessible in the wild mRNA due to its SS. When ss218178024G result in different mRNA SS the miRNA can access the target site as perfect complimentary of seed region is a key to the miRNA regulation. Nevertheless, recent evidence has discovered the significant miRNA expression in erythrocytes which dramatically altered in Sickle cell Disease (ref). Thus, our hypothesis in miRNA reg ulation of G6PD mRNA is reasonable. While, SS is able to modify half life of mRNA, it is also capable to influence interaction of specific sequence of mRNA with regulatory proteins or miRNAs. . Site accessibility is thought to affect the activity of a miRNA binding site. If the secondary structure is such that a potential miRNA binding site is part of a stable base-paired duplex, these bonds will need to be broken before miRNA::mRNA interaction can take place, effectively decreasing the fraction of mRNA molecules of a particular gene which is regulated by a miRNA in question. This could be one of the reasons some of the computational-predicted binding sites are inactive. Here, we demonstrate that a A357G mutation may potentially change the 3 ´UTR secondary structure and create a binding site for hsa-miR-877* affects G6PD expression by either inhibiting mRNA translation or inducing mRNA degradation (Can you explain this bit to me again when we meet). However, we gave evidence for the relevance of the SNP rs3 in G6PD deficiency in G6PD 1311/93 and possible explanation is linkage disequilibrium between this SNP with combination of 1311/93 inside of G6PD gene that might be affect the mRNA translation or stability through miRNA function. In conclusion, to the best of our knowledge, this study reports for the first time an association of a 3 UTR variant of G6PD in a large populations of G6PD 13111/93. However, functional studies are necessary to test this hypothesis. MicroInspector (http://www.imbb.forth.gr/microinspector) (Rusinov et al. 2005) W696-W700 Nucleic Acids Research, 2005, Vol. 33, Web Server issue MicroInspector: a web tool for detection of miRNA binding sites in an RNA sequence Ventsislav Rusinov, Vesselin Baev, Ivan Nikiforov Minkov and Martin Tabler Typically, SNPs occurring in functional genomic regions such as protein coding or regulatory regions are more likely to cause functional distortion and, as such, more likely to underlie disease-causing variations. Current bioinformatics tools examine the functional effects of SNPs only with respect to a single biological function. Therefore, much time and effort is required from researchers to separately use multiple tools and interpret the (often conflicting) predictions. (F-SNP Lee at al) The variant ESR1_rs2747648 affects the miRNA-binding site of miR-453, miR-181(b/d) and miR-219. Due to in silico analysis using miRanda (http://www.microrna.org/microrna/home.do), the variant ESR1_rs2747648 does not significantly effect the binding capacity of miR-219 and miR-181(b/d). However, the binding capacity of miR- 453 is stronger when the C variant allele is present, enabling to bind the complementary G nucleotide of the miR-453 seed. In contrast, the T allele attenuates the binding of miR-453, which we hypothesize to lead to a reduced miRNA-mediated ESR1-repression, in consequence higher ESR1 protein levels and an increased breast cancer risk. Therefore, the breast cancer protective effect observed for the C allele is biologically reasonable. However, functional studies are necessary to test this hypothesis. Due to the fact that endogenous estrogen levels are high premenopausal and drop down post-menopausal, it is plausible that the risk effect of this variant can only be detected in premenopausal women. RNA secondary structure prediction was carried out using the Vienna RNA Package 1.7.2. on the web interface for online RNA folding on the Vienna RNA WebServers.42 The target mRNA prediction was carried out using The microRNA.org resource This is likely because miRNA-mRNA binding is mediated by the RISC complex, and upstream and downstream regions of miRNA binding site may interact with RISC, which mediates miRNA-mRNA binding (26). A polymorphism in the 829C site (SNP-829C3T) is located near the miRNA binding site. 2007 Mishra mirna SNP rs12720208 is located 166 bp downstream of the terminating codon of FGF20 and lies within a predicted binding site for microRNA (miRNA) miR-433. (A) The predicted binding site for miR-433 at 30 UTR of FGF20 gene. At rs12720208, allele C base paired with G in Watson-Crick mode (as shown with a solid line), whereas allele T wobble base paired with G (as shown with a dashed line). ØØÂ ² Ù†¦Ãƒâ„¢Ã¢â‚¬Å¡ÃƒËœÃƒâ„¢Ã¢â‚¬Å¾Ãƒâ„¢Ã¢â‚¬ ¡ geenbee 2009 capasso Although the mechanism by which interaction of proteins with the G3A sequence might affect message stability remains a matter of speculation, the fact that this sequence is located within a large region of stable secondary structure in the 39-UTR of the elastin mRNA (4) suggests the possibility that RNA/protein interactions at this site may alter the stability of this secondary structure, perhaps affecting the accessibility of endogenous RNases to the mRNA. However, detailed understanding of the mechanism of this process awaits further characterization of the nature of binding protein and the consequences of its interaction with the G3A motif in elastin mRNA. Acknowledgment-We acknowledge GA rich Hew From a physical point of view, we expect that the interaction of a miRNA with its target will depend on the state of the target region prior to interaction. In particular, if the target sequence is already bound (by Watson-Crick base-pairing) to another section of the mRNA chain, this will e_ectively pose a barrier to the base-pairing with the miRNA, and the capacity of such target sequences to mediate translational repression could be diminished. If we were able to predict the accessibility of a potential miRNA binding site, this might improve our target predictions. gi|109132849|AGGGACAGCCCAGAGGA CTGAGCCACCTCCTGCGCTCACTCCAGCCCAACAGAAGGAAGGAGGAGGG gi|108773792| CTGAGTCACCTCCTCCACTCACTCCAGCCCAACAGAAGGAAGGAGGAGGG gi|194680256| CTGAGCCCCCCCCCCCCCACCCCACCGCCCGG-AGCAAGGAAGAGGAGGG ***** * ** ** * * * * * **** ** * * * ******** gi|109132849|AGGGACAGCCCAGAGGA TGCCCATTCGTCTGTCCCAGAGCTTCTCGGTCACTGGGGCTCACTCCTGA gi|108773792| CGCCCATTCGTCTGTCCCAGAGCTTATTGGCCACTGGGTCTCACTCCTGA gi|194680256| CTATAGTTGGGGAAGACAGGGGCAAGGTCCTCAGAAGGCCGAGA ** * * * ** ** ** * ** gi|109132849|AGGGACAGCCCAGAGGA GTGGGGCCTGGGGCAGGAGGGAGGGACGAGGGGGAGGAAAGGGGCGAGCG gi|108773792| GTGGGGCC-AGGGTGGGAGGGAGGGACAAGGGGGAGGAAAGGGGCGAGCA gi|194680256| ATGGGCCCCCTGCACCCCCAGTCTCAGCGCCATTCCACATTCCTGGTC It would be anticipated that increased DHFR reduces MTX cytotoxicity in normal cells while conferring resistance in target cells. A comparison of the human and mouse DHFR 39-UTR sequences revealed that only 100 nucleotides downstream from the terminator codon were conserved between the two species (18). Numerous studies have focused on the effects of coding region variants on P-gp expression and function, whereas few noncoding region variants have been investigated. Mechanisms that alter mRNA levels can change mRNA expression and potentially G6PD activity. Recent evidence has demonstrated that the 3UTR of mRNA is an important regulatory site controlling interactions with mRNA degradation machinery (Hollams et al., 2002; Tourriere et al., 2002; Mangus et al., 2003; Wilkie et al., 2003). 3UTR RNA-binding proteins that recognize specific mRNA sequence elements and secondary structure dictate the fate of mRNA transcripts. Polymorphisms in the 3UTR of G6PD could disrupt RNA-protein interactions, resulting in altered mRNA stability. The stability of mRNA may be altered by 3UTR polymorphisms if recognition of specific mRNA sequence and secondary structure by regulatory proteins is disrupted (Shen et al., 1999; Hollams et al., 2002; Tourriere et al., 2002). A polymorphism in the 3UTR of human tumor necrosis factor-_ changes binding affinity for a multiprotein complex that contains the HuR regulatory protein (Di Marco et al., 2001). HuR binds AG-rich elements in the 3UTR of certain genes (Peng et al., 1998) and has been shown to stabilize mRNA containing tumor necrosis factor-_ 3_-UTR sequence motifs (Dean et al., 2001). There is one report that the 3435C_T synonymous variant decreases mRNA stability (Wang et al., 2005), but to our knowledge no pharmacogenetic research of this type has been conducted for ABCB1 3_-UTR variants. Thus, our mRNA half-life data represent novel findings as to the effects the _89A_T, _146G_A, and _193A_G polymorphisms have on ABCB1 mRNA stability and demonstrate the utility of using stable cell lines made with Flp-In technology for these measurements. Similarly

Monday, August 19, 2019

La Curacion Plena :: Spanish Essays

La Curacion Plena Tres Fuentes Citadas  Ã‚  Ã‚  Ã‚   "Una noche me sentà ­ deprimida y con deseos de suicidio otra vez; sin embargo a pesar de estos sentimientos, tambià ©n de alguna manera sentà ­ una profunda confianza en Dios. No quise que los nià ±os me vieran llorar asà ­ que despuà ©s de acostarles, me encerrà © en el cuarto de baà ±o, me acurruquà © en el suelo, y repetà ­ una y otra vez: "Jesà ºs, confà ­o en Ti". No sà © cuà ¡ntas horas estuve asà ­, pero bien entrada la noche tuve una experiencia que cambià ³ mi vida. Sentà ­ que estaba en la cruz con Jesucristo pero que en lugar de sentir sufrimiento, sentà ­a un amor tan intenso que era capaz de apagar ese dolor. Sentà ­ como Su amor borraba mi pecado y supe entonces que mi curacià ³n era plena. Desde ese momento nunca mà ¡s he vuelto a sentir la desesperacià ³n del aborto, à ºnicamente el amor profundo y el perdà ³n que recibà ­ de Jesucristo. He visto cà ³mo mi vida ha cambiado milagrosamente, cà ³mo he tenido el privilegio de ayudar a infinidad de mujeres y hombres que sufren de las consecuencias del aborto. El amor de Jesucristo no sà ³lo ha transformado mi vida sino tambià ©n la vida de aquellos a los que amo." (Bonopartis) Las consecuencias de un aborto:    MUERTE: "Me siento muerta, muerta, muerta por dentro". "Cuando salà ­ de la clà ­nica, dejà © parte de mi corazà ³n allà ­ tambien". "Me debà ­a haber muerto con el bebà ©". "Siento que quiero morirme por dentro". "Siento que nunca debà ­a haber nacido, y muchas veces quisiera morirme". "Quisiera ser yo la muerta y no mi bebà ©". "Querà ­a morirme con mi hijo". "Cuando te separaron de mi... me quitaron un pedazo de mi alma y de mi corazà ³n que nunca podrà ¡ ser reemplazado". "Parte de mà ­ murià ³ el dà ­a que me separaron de ti". "No querà ­a ir, pero estaba demasiado cansada para pelear, ni siquiera podà ­a pensar. Dejà © de sentir. No era mi verdadero yo ese dà ­a, era otra persona. Ya no sà © dà ³nde està ¡ ese yo mà ­o. Creo que murià ³ ese dà ­a". "Siento que no valgo nada, que quisiera morirme para escapar el dolor y la culpabilidad..." NO PUEDO LAMENTARME/OTROS NO ENTIENDEN: "Sentà ­ que algo andaba mal conmigo por sentirme tan afectada por mi aborto como lo estaba", "Durante largo tiempo no podà ­a hablarle a nadie sobre eso y si lo hacà ­a todos estaban de acuerdo que yo no habà ­a hecho nada malo.

Sunday, August 18, 2019

Animal Farms Essay -- Literary Analysis, Orwell

Though Communism started in the early 1900s, its adverse effects are still felt in modern economies, global relations, and even literature such as Animal Farm by George Orwell. Communism started under the rule of Vladimir Lenin a man who brought prosperity and reform. Then it was passed down to the vengeful dictator Joseph Stalin. After several changes in power, it remains as an economic and political system. Like the animals in Animal Farm the people want a great change, and are willing to stop at no cost. However, like the Russian people they soon find out that by using communism to free them from bondage, they are only slaves to a new master and lose all reminisce of past culture. The winter of 1917 was one of the harshest winters Russia had faced in years. Food was scarce and the people were ravaged with disease. Peasants morosely toiled in the fields only to see their harvest consumed by the aristocracy. Each day was a prolonging of the inevitable revolution to come. However, like all great revolutions, they needed both an ideological leader, and one with the ability to carry out the actual revolution. These qualities were found in Karl Marx and Vladimir Lenin. Like Old Major in Animal Farm, Karl Marx spurs the revolution with the idea that the proletariats no longer have to be subservient to the Bourgeoisie (Marx xi). The animals had the incentive to follow Old Major, because he envisioned a totally equal society and wonders such as hot and cold water in all barns. A classless society appealed to the majority of Russians of whom 80% were serfs (Gottfried 79). Now that the ideological aspect had been taken care of they just needed someone to put the plan in to action. Vladimir Lenin was the head of the Bolshevik (those of ... ...Putin is the current Prime Minister of Russia and has said he wishes to run again in the next elections. Though the Cold War has been over for more than 19 years communism has soured Russian relations with the U.S. and all the countries it previously occupied. Russia is still undergoing economic and political transition, but like the animals in Animal Farm, in order to gain freedom they have become their own worst enemies; capitalists. In conclusion the deceiving lure of utopian communism is depicted in Animal Farm by George Orwell. Like the Russian people the animals hope to have a totally equal society, but for this dream they must sacrifice much more. They eventually succumb to totalitarian communism and in order to gain freedom must pay the ultimate price. For the animals it was becoming the humans and for the Russian people it was succumbing to capitalism.